Information

Does inorganic particles have pattern recognition receptor?

Does inorganic particles have pattern recognition receptor?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Does silica or carbon particles (inorganic substances causing silicosis and anthracosis) have Pattern Recognition Receptor (PRR) on macrophages/dendritic cells? Because phagocytic activity depends on PRR. If it doesn't have how it engulfs it?


  • Pathogens are recognized by a variety of immune cells, such as macrophages and dendritic cells, via pathogen-associated molecular patterns (PAMPs) on the pathogen surface, which interact with complementary pattern-recognition receptors (PRRs) on the immune cells&rsquo surfaces.
  • Upon binding of PRRs with PAMPs (pathogen recognition), immune cells release cytokines to tell other cells to start fighting back.
  • One class of cytokines, interferons, warn nearby uninfected cells of impending infection, cause cells to start cleaving RNA and reduce protein synthesis, and signal nearby infected cells to undergo apoptosis.
  • Another class of cytokines, called inerleukins, mediate interactions between white blood cells ( leukocytes ) and help bridge the innate and adaptive immune responses.
  • Inflammation (hot, red, swollen, painful tissue associated with infection) is encouraged by cytokines that are produced immediately upon pathogen recognition the increase in blood flow associated with inflammation allows more leukocytes (a type of innate immune cell) to reach the infected area.
  • macrophage: a white blood cell that phagocytizes necrotic cell debris and foreign material, including viruses, bacteria, and tattoo ink part of the innate immune system
  • phagocytosis: the process where a cell incorporates a particle by extending pseudopodia and drawing the particle into a vacuole of its cytoplasm
  • cytokine: any of various small regulatory proteins that regulate the cells of the immune system they are released upon binding of PRRs to PAMPS

Access options

Get full journal access for 1 year

All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.

Get time limited or full article access on ReadCube.

All prices are NET prices.


Phagocytosis and Inflammation

The first cytokines to be produced are pro-inflammatory that is, they encourage inflammation, the localized redness, swelling, heat, and pain that result from the movement of leukocytes and fluid through increasingly permeable capillaries to a site of infection. The population of leukocytes that arrives at an infection site depends on the nature of the infecting pathogen. Both macrophages and dendritic cells engulf pathogens and cellular debris through phagocytosis.

A neutrophil is also a phagocytic leukocyte that engulfs and digests pathogens. Neutrophils, shown in the figure below, are the most abundant leukocytes of the immune system. Neutrophils have a nucleus with two to five lobes, and they contain organelles, called lysosomes, that digest engulfed pathogens. An eosinophil is a leukocyte that works with other eosinophils to surround a parasite it is involved in the allergic response and in protection against helminthes (parasitic worms).

Neutrophils and eosinophils are particularly important leukocytes that engulf large pathogens, such as bacteria and fungi. A mast cell is a leukocyte that produces inflammatory molecules, such as histamine, in response to large pathogens. A basophil is a leukocyte that, like a neutrophil, releases chemicals to stimulate the inflammatory response as illustrated in the figure below. Basophils are also involved in allergy and hypersensitivity responses and induce specific types of inflammatory responses. Eosinophils and basophils produce additional inflammatory mediators to recruit more leukocytes. A hypersensitive immune response to harmless antigens, such as in pollen, often involves the release of histamine by basophils and mast cells.

In response to a cut, mast cells secrete histamines that cause nearby capillaries to dilate. Neutrophils and monocytes leave the capillaries. Monocytes mature into macrophages. Neutrophils, dendritic cells and macrophages release chemicals to stimulate the inflammatory response. Neutrophils and macrophages also consume invading bacteria by phagocytosis.

Cytokines also send feedback to cells of the nervous system to bring about the overall symptoms of feeling sick, which include lethargy, muscle pain, and nausea. These effects may have evolved because the symptoms encourage the individual to rest and prevent them from spreading the infection to others. Cytokines also increase the core body temperature, causing a fever, which causes the liver to withhold iron from the blood. Without iron, certain pathogens, such as some bacteria, are unable to replicate this is called nutritional immunity.

Resource:

Watch this 23-second stop-motion clip showing a neutrophil that searches for and engulfs fungus spores during an elapsed time of about 79 minutes.


PTX3 protein structure

The human PTX3 protomer is a 381 amino acid glycoprotein, including a 17 amino acid signal peptide for secretion. PTX3 primary sequence is highly conserved among animal species (human and murine PTX3 sharing 92% of conserved amino acid residues), suggesting a strong evolutionary pressure to maintain its structure-function relationships [1]. As the other members of the long-pentraxin subfamily, PTX3 is composed of an unique N-terminal domain (spanning amino acid residues 1�) and of a Cterminal 203 amino acid domain highly homologous among the various members of the pentraxin family (57% of conserved amino acids with short-pentraxins CRP and SAP).

No crystallographic data are available for the Nterminal portion of long-pentraxins. We performed consensus secondary structure prediction of PTX3 N-terminus [42]. Four α-helix regions connected by short loops have been identified that span amino acid residues 55� (㬚), 78� (㬛), 109� (㬜), and 144� (㬝) ( Fig. 3A ). Moreover, 㬛 contains the structural heptad repeat motif (abcdefg) spanning amino acid residues 85�, where a and d are hydrophobic residues and e and g represent charged residues [43]. Also, hydrophobic residues repeated with a period of one each three or six amino acids are present within the primary sequence of 㬜 and 㬝. Thus, 㬛, 㬜, and 㬝 helices of the N-terminal PTX3 domain have propensity to be in a coiled-coil conformation (as predicted by Coils2 http://www.ch.embnet.org/software/COILS_form.html). Moreover, the occurrence of short loops between α-helices suggests an up-down topological distribution ( Fig. 3B ).

PTX3 protein structure. (A) - Amino acid sequence (single letter code) and prediction of the secondary structure of the PTX3 N-terminus (residues 1-178): h =α helix e =β-sheet c = random coil t =β-turn. Coiled-coil regions are underlined and the signal sequence is in Italics. (B) - Topological representation of PTX3 N-terminus cysteine residues are highlighted. (C) - Model of the PTX3 C-terminus obtained by homology modelling with the crystallographic structure of CRP. Residue Asn 220 and the Cys 210 - Cys 271 disulphide bridge are represented by sticks. The α-helix is shown in red.

As described below, PTX3 binds with high affinity the angiogenic polypeptide fibroblast growth factor-2 (FGF2) [44]. The putative minimal linear FGF2 binding region in PTX3 comprises amino acid residues 97� [42]. This binding domain is predicted in an exposed loop region that comprises the end of the 㬛-helix (Glu 97 ), a β-turn on residues Ala 104 -Pro 105 -Gly 106 -Ala 107 , and the first two residues of the 㬜-helix (Ala 109 -Glu 110 ) [42].

The N-terminal sequence of PTX3 contains three cysteine residues in positions 47, 49, and 103. Three cysteine residues are present also in the N-terminal coiled-coil α-helices of the human long-pentraxins NP1 and NP2 in the positions 16, 26, 73 and 14, 26, 79, respectively [10]. These residues are engaged in inter-chain disulphide bonds, thus providing stability to the multimeric status of NP1 and NP2 [10]. The similar distribution of N-terminal cysteine residues in NP1, NP2, and PTX3 in terms of relative distances suggests that Cys 47, 49, 103 within the PTX3 N-terminus may exert an analogous structural role. In spite of no obvious primary sequence similarity between PTX3 N-terminus and other known proteins, the occurrence of α-helices in coiled-coil conformation and the likelihood of cysteine residues engaged in inter-chain disulphide bonds suggest a structural similarity between the N-terminal region of PTX3 and the N-terminal domain of the members of the collectin family, including the mannose-binding protein (MBP) and the surfactant proteins A and D (SP-A and SP-D) [45]. This structural similarity well matches with the role of these collectins and of PTX3 as humoral components of the innate immune system [45].

The high similarity of the primary sequence of the PTX3 C-terminus with short-pentraxins allowed to produce a predicted structure for the C-terminal PTX3 region (residues 179�) using the crystallographic structure of CRP as template (PDB code: 1B09). The model of PTX3 C-terminus presents a hydrophobic core composed by two anti-parallel β-sheets organised in a typical β-jelly roll topology ( Fig. 3C ). A similar model was described when PTX3 was modelled on the tertiary structure of SAP [46]. A single α-helix spanning amino acid residues 344� is located on the protein surface, whereas Cys 210 and Cys 271 are located on opposite sites of the two anti-parallel β-sheets. These cysteine residues are conserved among pentraxins and since they establish a disulphide bond in CRP and SAP, they were imposed also in the C-terminal model of PTX3 as covalently linked. The proximity of Cys 179 and Cys 357 within the model suggests that they are reciprocally engaged in another disulphide bond, thus potentially linking the N-terminal end of PTX3 to the tail of the C-terminal domain [46].

PTX3 contains a unique N-glycosylation site at Asn 220 which is located on an exposed loop of the C-terminal domain [47]. The PTX3 protein is conjugated with complex-type oligosaccharides, mainly biantennary fucosylated and terminally sialylated structures [47]. It has been proposed that the negatively charged sialic acid residues may establish ionic interactions with polar and basic amino acids located far from the Asn220 N-glycosylation site [47]. As detailed below, the glycosidic moiety is involved in a fine tuning of the interaction of PTX3 with the complement fraction C1q [47].

PTX3 protomers form higher ordered multimeric structures that, at variance with classical pentraxins CRP and SAP, are stabilized by a network of interchain disulphide bonds [25]. Gel electrophoresis under native conditions has shown that PTX3 subunits form multimers with an apparent molecular weight of 440 kDa. However, PTX3 behaves anomalously in size exclusion chromatography being eluted as a 900 kDa protein [25]. No data are available to discriminate whether this chromatographic behaviour reflects the ability of PTX3 to form larger multimeric structures or whether PTX3 multimers have a high hydrodynamic volume.

Attempts to predict the quaternary structure of PTX3 were performed by replacing one of the subunits of the pentameric ring of SAP with the model of the PTX3 C-terminus [2]. The residue substitution pattern and primary sequence analysis of the modelled interfaces indicates the presence of several non-conservative substitutions. Thus, the quaternary structure of PTX3 may not be easily traced from the known structure of the other pentraxins. This limitation, together with the lack of information about the relative organization of the N-terminal and C-terminal domains, do not allow us to draw any ultimate conclusion about the quaternary structure of PTX3.


Movement of Pattern Receptors

Pattern receptor proteins are moved, taken apart and rebuilt through many different cellular compartments. The endoplasmic reticulum (ER) has many different factors that interact with TLRs, creating vesicles that move and eliminate them.

When a TLR receptor protein is first created in the ER and then folded into the correct shape, special factors for each of the different TLRs help transport them to the membrane for their working position. Special lipoproteins and immune factors are necessary for this complex process. A different set of factors are necessary when the receptor needs amplification of its stimulus of cytokines to initiate inflammation. Special immune factors like CD14 are necessary for this process, which can occur in special vesicles called endosomes.

Stimulation of lipopolysaccharides (LPS) plays a significant part of this process in bringing more receptors from the ER and Golgi to the membrane. This is absolutely necessary to fight against microbes and its regulation is necessary to avoid autoimmune disease.


Abstract

Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain receptors (NLRs) are families of pattern recognition receptors that, together with inflammasomes, sense and respond to highly conserved pathogen motifs and endogenous molecules released upon cell damage or stress. Evidence suggests that TLRs, NLRs and the NACHT, LRR and PYD domains-containing protein 3 (NLRP3) inflammasome have important roles in kidney diseases through regulation of inflammatory and tissue-repair responses to infection and injury. In this Review, we discuss the pathological mechanisms that are related to TLRs, NLRs and NLRP3 in various kidney diseases. In general, these receptors are protective in the host defence against urinary tract infection, but can sustain and self-perpetuate tissue damage in sterile inflammatory and immune-mediated kidney diseases. TLRs, NLRs and NLRP3, therefore, have become promising drug targets to enable specific modulation of kidney inflammation and suppression of immunopathology in kidney disease.


Chemokine Receptors in Cancer Progression

Cancer progression is strongly influenced by chemokine-dependent leukocyte recruitment and infiltration into primary tumors as well as by the subsequent dissemination of cancer cells from primary tumors into adjacent and distant tissues (15, 76, 89). Live visualization of fluorescently labeled tumor cells in zebrafish larvae enables early assessment of vascular remodeling events, tumor dissemination, and metastasis at the organismal level (24, 64). Zebrafish cancer models are also suitable to image early tumor-initiation events and the crucial interplay between the tumor cells and the microenvironment (45). In particular, xenotransplantation models, in which human invasive cells are systemically inoculated into zebrafish larvae, are useful to assess the interactions between human tumor cells and host leukocytes that underlie early metastatic onset (67). Additionally, the larval zebrafish system offers a simple and robust screening platform for anti-tumor compounds targeting different stages (angiogenesis, metastasis, etc.), further emphasizing its translational value (24, 64).

The tumor environment is a highly inflammatory focus that attracts leukocytes through secretion of cytokines of different natures, including chemokines (45). Chemokine receptors CXCR1, 2, 3, 4, and 7 have been implicated in tumor angiogenesis, sustaining tumor growth and expansion both in zebrafish and humans, as discussed below. The role of CCR chemokine receptors in cancer using the zebrafish model has not been addressed yet.

The Cxcr1/Cxcr2-Cxcl8 Axis in Cancer

Neutrophils are the first responders to acute inflammation, infection, and damage. These cells exhibit remarkable phenotypic plasticity that is determined by the integration of extracellular cues (45). In zebrafish, cancer cells recruit neutrophils through chemokine receptors Cxcr1 and 2 and their Cxcl8 ligands (15, 75). Neutrophil populations have a dual role in the development of different cancers. Tumor-associated neutrophils (TANs) directly engage with tumor cells and are reported to support tumor growth, tissue invasion and angiogenesis mimicking sites of chronic inflammation. In contrast, anti-tumor neutrophils undergo apoptosis and reverse migration back into the vasculature, thereby favoring the resolution of inflammation (45, 75). Using the zebrafish model, it became clear that TANs are recruited to tumor-initiating sites through the Cxcr1-Cxcl8a pathway and that in this context, Cxcr2 is not required for efficient neutrophil recruitment. Fewer neutrophils are recruited to tumor-initiating foci in cxcr1 mutant zebrafish larvae and proliferation of tumor cells is restricted, suggesting that TANs are critical for early stages of neoplasia and tumorigenesis (75). In agreement with these observations, Cxcr1 expression is lower in anti-tumor neutrophils that display a predominantly anti-inflammatory phenotype (52, 68).

The Cxcr4a/b-Ackr3𠄼xcl12 Axis in Cancer

A vast body of literature associates the chemokine receptor CXCR4 with the development of cancer pathogenesis in humans, mice and zebrafish (6, 15, 24, 50, 74). Cxcr4b is highly expressed on zebrafish neutrophils and together with its ligand Cxcl2a, it facilitates tumor angiogenesis and dissemination into different tissues by attracting malignant Cxcr4-expressing cells into healthy organs and tissues where ligand can be found (63, 74, 76). Zebrafish larvae lacking cxcr4b (ody mutants) fail to induce micrometastases and to sustain human cancer cells after xenotransplantation. Basal neutrophil motility is attenuated and whole-body neutrophil counts are lower in cxcr4b mutants than in wild type (wt) larvae (67). Accordingly, tumors in cxcl12a mutant zebrafish cannot metastasize, further supporting that Cxcr4b signaling promotes tumor expansion (64).

While neutrophils are important cellular mediators of inflammation and play a central role in tumor initiation and expansion macrophages represent a significant amount of the leukocytes that infiltrate tumors. Macrophages phagocytose cancer cells and dying neutrophils whilst secreting immunomodulatory cytokines. Macrophages also express Cxcr4b and respond to Cxcl12a (11, 90). A study focused on glioblastoma progression used the zebrafish model to show that tumor cells secrete Cxcl12a to recruit macrophages to the tumor site (90). Cxcr4b-Cxcl12a signaling in macrophages is also linked to tumor-promoting functions by enhancing proliferation and invasiveness, modifying the extracellular matrix and favoring tumor neovascularization (15, 28, 65). Interestingly, live visualization of zebrafish macrophages and microglia showed dynamic interactions with cancer cells which did not result in phagocytosis of the malignant cells, thereby avoiding an anti-tumor function of macrophages (67). cxcr4b mutant larvae had a lower tumor burden in this context too and depletion of macrophages and microglia significantly reduced oncogenic cell proliferation, suggesting that Cxcr4b signaling promotes macrophage infiltration during initial stages of brain cancer (90).

As discussed above, Cxcr4b signaling can be fine-tuned through ligand scavenging by the atypical Ackr3b receptor. Human ACKR3is linked to tumor growth, invasion, and metastasis (11). Tumor cells and vascular endothelial cells of different tissues show an increased expression of Ackr3 and it has been suggested to include this receptor as a marker for cancer (63). A study by van Rechem et al. (91) found that Ackr3 is a direct target of the tumor suppressor HIC1 (Hypermethylated in Cancer 1) which is inactive in many human tumors. The role of Ackr3b in cancer pathogenesis is still unknown in zebrafish and as multiple studies found that Ackr3b depletion results in severe developmental abnormalities (6, 29, 30, 37), a gene knockout/down approach to assessing its role in cancer progression would require the development of cell-specific or conditional knockout systems.


2. GENOMICS STRUCTURE AND BIOLOGICAL FEATURES OF SARS𠄌OV𠄂

Coronaviruses belong to the order Nidovirales in the family coronaviridae. Coronavirinae and Torovirinae subfamilies are divided from the family. The subfamily Coronavirinae is further divided into four genera: Alpha‐, Beta‐, Gamma‐ and Deltacoronavirus. 15 Phylogenic analysis revealed that SARS𠄌oV𠄂 is closely related to the beta𠄌oronaviruses. Similar to other coronaviruses, the genome of SARS𠄌oV𠄂 is positive‐sense single‐stranded RNA [(+) ssRNA] with a 5′�p, 3'‐UTR poly(A) tail. The length of the SARS𠄌oV𠄂 genome is less than 30 kb, in which there are 14 open reading frames (ORFs), encoding non‐structural proteins (NSPs) for virus replication and assembly processes, structural proteins including spike (S), envelope (E), membrane/matrix (M) and nucleocapsid (N), and accessory proteins. 16 , 17 The first ORF contains approximately 65% of the viral genome and translates into either polyprotein pp1a (nsp1�) or pp1ab (nsp1�). Among them, six nsps (NSP3, NSP9, NSP10, NSP12, NSP15 and NSP16) play critical roles in viral replication. Other ORFs encode structural and accessory proteins. 18 , 19 The S protein is a transmembrane protein that facilitates the binding of viral envelop to angiotensin𠄌onverting enzyme 2 (ACE2) receptors expressed on host cell surfaces. Functionally, the spike protein is composed of receptor binding (S1) and cell membrane fusion (S2) subunits. 20 The N protein attaches to the viral genome and is involved in RNA replication, virion formation and immune evasion. The nucleocapsid protein also interacts with the nsp3 and M proteins. 21 The M protein is one of the most abundant and well𠄌onserved proteins in the virion structure. This protein promotes the assembly and budding of viral particles through interaction with N and accessory proteins 3a and 7a. 22 , 23 The E protein is the smallest component in the SARS𠄌oV𠄂 structure that facilitates the production, maturation and release of virions. 18

The most complex component of the coronaviruses genome is the receptor𠄋inding domain (RBD) in the spike protein. 24 , 25 Six RBD amino acids are necessary for attaching to the ACE2 receptor and hosting SARS𠄌oV‐like coronaviruses. According to multiple sequence alignment, they are Y442, L472, N479, D480, T487 and Y4911 in SARS𠄌oV, and L455, F486, Q493, S494, N501 and Y505 in SARS𠄌oV𠄂. 26 Therefore, SARS𠄌oV𠄂 and SARS𠄌oV vary with respect to five of these six residues. The SARS𠄌oV strain genome sequences derived from humans were very close to those in bats. Even so, several differences have been identified between the gene sequences of the S gene and the ORF3 and ORF8 gene sequences that encode the attachment and fusion proteins and replication proteins, respectively. 27 Specific MERS𠄌oV strains derived from camels were shown to be identical to those extracted from humans, with the exception of differences between the genomic regions S, ORF4b and ORF3. 28 In addition, genome sequencing�sed experiments have shown that human MERS𠄌oV strains are phylogenetically linked to those of bats. However, for the S proteins, the species have a similar genome and protein structures. 29 Based on the recombination studies of orf1ab and S encoding genes, the MERS𠄌oV was derived from the interchange of genetic elements between coronaviruses in camels and bats. In comparison, with a 96% overall identification, the primary protease is strongly protected among SARS𠄌oV𠄂 and SARS𠄌oV. 29 , 30 , 31

The ACE2 protein is found in many mammalian body tissues, primarily in the lungs, kidneys, gastrointestinal tract, heart, liver and blood vessels. 32 ACE2 receptors are vital elements in regulating the renin𠄊ngiotensin𠄊ldosterone system pathway. Based on structural experiments and biochemical studies, SARS𠄌oV𠄂 appears to have an RBD that strongly binds to ACE2 receptors of humans, cats, ferrets and other organisms with the homologous receptors. 33

The genome sequencing of SARS𠄌oV𠄂 in January 2020 was shown to be 96% identical to the bat coronavirus (BatCoV) RaTG13 genome and 80% identical to the SARS𠄌oV genome. 34 However, significant differences exist. For example, the protein 8a sequence in the SARS𠄌oV genome is absent in the 2019‐nCoV, and the protein 8b sequence of SARS𠄌oV𠄂 is 37 amino acids longer than that in SARS𠄌oV. 35

Alignment sequence analysis of the CoV genome indicates non‐structural and structural proteins being 60% and 45% identical, respectively, among various types of CoVs. 36 These data show that nsps are more conservative than structural proteins. RNA viruses have a higher mutational load as a result of shorter replication times (Figure  1 ). 36 Based on comparative genomic studies between SARS𠄌oV𠄂 and SARS‐like coronaviruses, there are 380 amino acid substitutions in the nsps genes and 27 mutations in genes encoding the spike protein S of SARS𠄌oV𠄂. These variations might explain the different behavioral patterns of SARS𠄌oV𠄂 compared to SARS𠄌oVs. 8 For example, the primary N501 T mutation in the Spike protein of SARS𠄌oV𠄂 could have significantly increased its binding affinity to ACE2. 37

The schematic genomic structure of coronavirus. (a) COVID�. (b) MERS𠄌oV. (c) SARS𠄌oV. The typical coronavirus genome is a single‐stranded, which is approximately 25� kb. It contains 5' caps and 3'‐UTR tails. (d) Coronavirusencoding structural proteins four structural genes, including spike, envelope, membrane and nucleocapsid genes, as well as accessory proteins (3a, 3b, 6, 7a, 7b, 8b, 9b and ORFs)

2.1. Pathogenesis of SARS𠄌oV𠄂

The entry of the SARS𠄌oV𠄂 into host cells and release their genomes into target cells is dependent on a sequence of steps. The virus uses the protein spike, which is important for assessing tropism and virus transmissibility. Additionally, SARS𠄌oV𠄂 even targets human respiratory epithelial cells with ACE2 receptors, indicating a structure of RBD similar to SARS𠄌oV. 38 After attachment of the S1‐RBD to the ACE2 receptor, host cell‐surface proteases such as TMPRSS2 (transmembrane serine protease 2) act on a critical cleavage site on S2. 38 This results in membrane fusion and viral infection. Following virus entry, the uncoated genomic RNA is translated into polyproteins (pp1a and pp1ab) and then assembled into replication/transcription complexes with virus‐induced double‐membrane vesicles (DMVs). Subsequently, this complex replicates and synthesizes a nested set of subgenomic RNA by genome transcription, encoding structural proteins and some accessory proteins. Newly formed virus particles are assembled by mediating the endoplasmic reticulum and the Golgi complex. Finally, virus particles are budded and released into the extracellular milieu compartment. Thus, both the viral replication cycle and progression begin. 10

Inside the host cells, survival of SARS CoVs is maintained by multiple strategies to evade the host immune mechanism, which can also be generalized to SARS𠄌oV𠄂. 39 , 40 As a result of the lack of pathogen𠄊ssociated molecular patterns on DMVs originating from the first step of SARS𠄌oVs infection, they are not recognized by pattern recognition receptors of the host immune system. 25 Nsp1 can impede the interferon (IFN)‐I responses through several mechanisms, such as a silencing of the host translational system, the induction of host mRNA degradation and the repression of transcription factor signal transducer and activator of transcription (STAT)1 phosphorylation. Nsp3 antagonizes interferon and cytokine production by blocking the phosphorylation of interferon regulation factor 3 (IRF3) and interrupting the nuclear factor‐kappa B (NF‐㦫) signaling pathway. NSPs 14 and 16 cooperate to form a viral 5′ cap similar to that of the host. Thus, the viral RNA genome is not recognized by immune system cells. 41 The accessory proteins ORF3b and ORF6 can disrupt the IFN signaling pathway by inhibiting IRF3 and NF‐KB�pendent IFNβ expression and blocking the JAK‐STAT signaling pathway, respectively. Also, IFN signaling is flattened by structural proteins M and N, which result in a disturbance in TANK𠄋inding kinase 1 (TBK1)/IKB kinase ε and TRAF3/6‐TBK1‐IRF3/NF‐㦫/AP1 signals. 22 , 39 Because the D614 G mutation is found in the outer spike protein of the virus, this attracts a huge amount of attention from the human immune system and may therefore impair the ability of SARS𠄌oV𠄂 to avoid vaccine‐induced immunity. D614 G is not in the RBD, although it is involved in the interaction between individual spike protomers that regulate their mature trimeric form on the surface of the virion by hydrogen bonding. 42 Korber et al. reported that the SARS𠄌oV𠄂 variant in the D614 G spike protein has become influential across the globe. Although clinical and in vitro evidence indicate that D614 G alters the phenotype of the virus, the effect of the mutation on replication, pathogenesis, vaccine and therapy development is relatively unknown. 43 From in vitro and clinical evidence, it is apparent that D614 G has a distinct phenotype, although it is not clear whether this is the outcome of verified adaptation to human ACE2, as well as whether it enhances transmissibility, or will have a significant impact. 43

2.2. Diagnosis of COVID�

Early diagnosis and isolation of suspected patients play a vital role in controlling this outbreak. 44 The specificity and sensitivity of different diagnostic techniques differs between populations and the types of equipment employed. 45 Several proceedures have been recommended for the diagnosis of COVID�:

COVID� symptoms are observed approximately 5 days after incubation. 46 The median time of symptom onset from COVID� incubation is 5.1 days, and those infected display symptoms for 11.5 days. 47 This duration was shown to have a close link with the patient's immune system and age. Gastrointestinal symptoms include diarrhea, vomiting and anorexia, recorded in almost 40% of patients. 48 , 49 Up to 10% of patients with gastrointestinal symptoms show no signs of fever or respiratory tract infections. 50 COVID� has also been linked to hypercoagulable disease, elevating the risk of venous thrombosis. 51 There are also records of neurological symptoms (such as fatigue, dizziness and disturbed awareness), ischemic and hemorrhagic strokes, and muscle damage. 52 Many extrapulmonary symptoms comprise skin and eye manifestations. Italian researchers have identified skin manifestations in 20% of patients. 53 The clinical outlook for children can progressively worsen as a result of respiratory failure, which could not be corrected within 1𠄳 days by traditional oxygen (i.e. nasal catheter 54 ) in severe cases the hallmarks are septic shock, sepsis, extreme and continuum bleeding as a result of coagulation abnormalities, and metabolic acidosis. 55

Septic shock could cause severe damage and impair several organs, in addition to a severe pulmonary infection. When extrapulmonary system dysfunction occurs, including the circulatory and the digestive systems, septic shock is probable, and the mortality rate increases substantially. 55 Premature delivery and intrauterine hypoxia occur when the prenate is deprived of an adequate environment of oxygen. Insidious symptoms require specific care in some newborn and preterm infants. Reports have indicated a good prognosis for children within 1 or 2 weeks. 55 Children are prone to a hyperinflammatory response to COVID� similar to Kawasaki disease, which responds well to management, for which a new term is being coined. 56

Also, considerable research has revealed the age distribution of adolescent patients between the ages of 25 to 89 years. Many elderly patients were between 35 and 55 years, and fewer cases among newborns and infants were found. An analysis of the initial transmission dynamics of the virus showed that the median age of patients was 59 years, varying from 15 to 89 years most (59%) were male. 48

Nonspecific screening tests for COVID� in exposed patients

The findings of most blood tests are usually nonspecific but could help determine the causes of the disease. A complete blood count typically shows a normal or low count of white blood cells and lymphopenia. C‐reactive protein (CRP) and erythrocyte sedimentation rate were generally increased, which would optimally be rechecked on days 3, 5 and 7 after admission. 1 , 57 , 58 Creatine kinase plus myoglobin, aspartate aminotransferase and alanine aminotransferase, lactate dehydrogenase, D𠄍imer, and creatine phosphokinase levels could be increased in severe forms of COVID� disease. During viral�terial co‐infections, procalcitonin levels may be elevated. 59 , 60 In a systematic review and meta𠄊nalysis study, Pormohammad et al. 61 investigated the accessible laboratory results obtained among 2361 SARS𠄌oV2 patients, with the results demonstrating 26% leukopenia, 13.3% leukocytosis and 62.5% lymphopenia. Also, among 2200 patients, 91% and 81% revealed elevated platelets (thrombocytosis) and CRP, respectively. 61 Additionally, a review of case studies identified clinical diagnosis and clinical parameter modification in a 47‐year‐old man diagnosed with the disease from Wuweian. 62

To investigate the effect of the coronavirus during the acute phase of the disease, plasma cytokines/chemokines tumor necrosis factor (TNF)‐α and interleukin (IL)𠄁β, IL1RA, IL2, IL4, IL5, IL𠄆, IL�, IL13, IL15 and IL17A were measured. 1 , 63 One study showed that macrophages and dendritic cells play crucial roles in an adaptive immune system. These cells contain inflammatory cytokines and chemokines, such as IL𠄆, IL𠄈, IL�, TNF‐α, monocyte chemoattractant protein𠄁, granulocyte‐macrophage colony‐stimulating factor and granulocyte colony‐stimulating factor. These inflammatory reactions could cause a systemic inflammation. 64

Therefore, fecal and urine tests have been recommended for patients and health staff to detect possible alternate transmission. Consequently, the advancement of tools for determining the different transmission modes, including fecal and urine samples, is urgently warranted to develop strategies for inhibiting and minimizing transmission, as well as develop therapies to control the disease. 65

Chest X‐ray examination may display diverse imaging characteristics or patterns in COVID� patients with a different disease severity and duration. Imaging results differ based on patient age, disease stage during screening, immune competency and drug therapy protocols. 66 On the other hand, computed tomagraphy (CT) imaging is essential for monitoring disease progression and assessing therapeutic effectiveness. It can be re𠄎xamined 1 to 2 days after admission, based on the Diagnostic and Treatment Protocols Regulation (DTPR). 67

The cardinal hallmark of COVID� was multiple, bilateral, posterior and peripheral ground‐glass opacities with or without pulmonary consolidation and, in severe cases, infiltrating shadows. 68 Autopsy analysis of a COVID� patient displayed fluid accumulation and hyaline membrane formation in alveolar walls, which may be the primary pathological driver of the ground‐glass opacity. 69

However, further studies indicated that small patchy shadows, pleural changes, a subpleural curvilinear line and reversed halo signs are generally observed in COVID� patients. 70 , 71 The intralobular lines and thickened interlobular septa were shown in a crazy‐paving pattern on the ground‐glass opacity background. 67 Also, several lobar lesions can be found in the respiratory system in children with a severe infection. Evidence showed that chest CT manifestations (pulmonary edema) reported for COVID� are generally close to SARS and MERS. 69

Evidence has indicated that an initial chest CT has a higher detection rate (approximately 98%) compared to reverse transcriptase‐polymerase chain reaction (RT‐PCR) (approximately 70%) in infected patients. Xie et al. 72 demonstrated that about 3% of patients have no primary positive RT‐PCR but have a positive chest CT therefore, both tests are recommended for COVID� patients. CT of the chest comprises an urgent and simple method for detecting initial COVID� infection with a high sensitivity for prompt diagnosis and disease progression monitoring in patients. Particular notice should be paid to the role of radiologists in finding novel infectious diseases.

The clinical diagnosis of COVID� is focused primarily on epidemiological data, clinical symptoms and some adjuvant technologies, such as nucleic acid detection and immunological assays. In addition, the isolation of SARS𠄌oV𠄂 requires high‐throughput equipment (biosafety level𠄃) to ensure personnel safety. Moreover, serological tests have not yet been validated. In the field of molecular diagnosis, there are three main issues: (i) decreasing the number of false negatives by detecting minimal amounts of viral RNA (ii) avoiding the number of false positives through the correct differentiation of positive signals between different pathogens and (iii) a high capacity for fast and accurate testing of a large number of samples in a short time. 73

2.3. Nucleic acid detection

Two widely used technologies for SARS𠄌oV𠄂 nucleic acid detection are the real‐time RT‐PCR (rRT‐PCR) and high‐throughput sequencing. Nevertheless, as a result of a reliance on equipment and high costs, high‐throughput sequencing in clinical diagnosis is restricted. Access to the whole genome structure of SARS𠄌oV𠄂 has helped the design of specific primers and has introduced the best diagnostic protocols. 47 , 74 In the first published reports on applying the rRT‐PCR in COVID� diagnosis, targeting the spike gene region (S) of SARS𠄌OV𠄂 has shown remarkable specificity and limited sensitivity. 68 Later, the sensitivity of this technique was greatly improved by the use of specific probes for the other viral‐specific genes, including RNA�pendent RNA polymerase (RdRp) in the ORF1ab region, Nucleocapsid (N) and Envelop (E). To avoid cross‐reaction with other human coronaviruses and prevent the potential genetic drift of SARS𠄌oV𠄂, two molecular targets should be involved in this assay: one nonspecific target to detect other CoVs, and one specific target for SARS𠄌oV𠄂. The comparison of the results obtained from targeting all studied genes exhibited that the RdRp gene is the most appropriate target with the highest sensitivity. The RdRp assays were validated in approximately 30 European laboratories using synthetic nucleic acid technology. 73 Currently, Chan et al. 75 have proposed a novel RT‐PCR assay targeting a sequence of the RdRp/Hel that could detect low SARS𠄌oV𠄂 load in the upper respiratory tract, plasma and saliva samples without any cross‐reactivity with other common respiratory viruses. Although the CDC‐recommended assays in the USA rely on two nucleocapsid proteins N1 and N2, the WHO recommends the E gene assay as a first‐line screening, followed by the RdRp gene assay as a confirmatory test. Based on the most recent evidence, the QIAstat𠄍x SARS𠄌oV𠄂 panel, a multiplex RT‐real time PCR system targeting genes RdRp and E, remains highly sensitive despite the nucleotide variations affecting the annealing of the PCR assay. 76

Generally, quantitative (RT‐PCR) RT‐qPCR has high specificity as a gold standard assay for the final diagnosis of COVID�. However, its sensitivity could be variable based on viral load, RNA extraction technique, sampling source and disease stage during the time of sampling. Indeed, the RT‐PCR false‐positive results are related to the cross𠄌ontamination of samples and handling errors. By contrast, inaccuracies during any stage of the collection, storage and processing of samples may lead to false‐negative results. Some studies have revealed that samples from the upper respiratory tract (bottom of the nostrils and the oropharynx) are more desirable for the RT‐PCR assay as a result of many viral copies. 77 Moreover, other shortcomings of RT‐qPCR assays include biological safety hazards arising from maintaining and working on patient samples, as well as time𠄌onsuming and cumbersome nucleic acid detection process. 66 , 68

To improve the molecular diagnostic techniques for COVID�, isothermal amplification�sed methods are currently in development. The loop‐mediated isothermal amplification (LAMP) utilizes the DNA polymerase and 4 to 6 different primers binding to the distinct sequences on the target genome. 78 In the LAMP reactions, the amplified DNA is indicated by turbidity arising from a by‐product of the reaction, a detectable color generated by a pH‐sensitive dye, or fluorescence produced by a fluorescent dye. 79 The approach occurs at a single temperature, in less than 1 hour, and with minimal background signals. The LAMP diagnostic testing for COVID� is more specific and sensitive compared to the conventional RT‐PCR assays and does not dependent on specialized laboratory equipment such as a thermocycler. However, as a result of the multiplicity of primers used in this method, optimizing the reaction conditions presents a major challenge. 80 , 81

2.4. Microarray�sed technique

Microarray is a rapid and high‐throughput method for the COVID� assay. 82 As a brief summary of the protocol, the coronavirus RNA will first produce cDNA labeled with specific probes via reverse transcription. Complementary DNA is produced by coronavirus RNA templates and then through reverse transcription labeling with particular probes. The labeled targets are hybridized to the probe microarray. Free DNAs are removed by washing the solution. Finally, particular probes identify COVID� RNA. 82 Shi et al. 83 successfully performed SARS𠄌oV detection in samples from patients. In their study, Xu et al. 84 investigated a wide range of spike gene polymorphisms with great accuracy. Also, other studies have designed fluorescence and nonfluorescence methods to detect the entire coronavirus genus with promising efficacy. 85 , 86 Jiang et al. 87 constructed a SARS𠄌oV𠄂 proteome microarray consisting of 18 out of 28 expected proteins and administered it to 29 convalescent cases to characterize the immunoglobulin (Ig)G and IgM reactions in the sera. It was revealed that all of these patients had IgM and IgG antibodies, which recognize and bind SARS𠄌oV𠄂 proteins, especially S1and N proteins. In addition to these proteins, important antibody responses to NSP5 and ORF9b are also recognized. The S1‐specific IgG signal relates strongly to age and lactate dehydrogenase lactate dehydrogenase levels and negatively relates to the lymphocyte ratio. Shen et al. progressed the RT‐LAMP experiment to show signals using a quenching probe with the same efficiency as the standard RT‐PCR test with respect to MERS𠄌oV identification. 80

Antigen detection and immunological techniques can be used for a rapid and cost�tive diagnosis at the same time as providing an alternative to molecular methods. Immunological techniques including the immunofluorescence assay, direct fluorescence antibody test, nucleocapsid protein detection assay, protein chip, semiconductor quantum dots and the microneutralization assay define a binding between a viral antigen and a specific antibody. 88 , 89 , 90 , 91 These immunological methods are simple to operate but have low specificity/sensitivity. In the case of COVID�, virus morphology can be observed by electron microscopy according to traditional Koch’s postulates. 92 , 93 Serological tests can improve coronavirus detection such that associated antigens and monoclonal antibodies can represent a new diagnostic approach for future development (Figure  2 ). 94 , 95

Diagnostic protocol recommended for COVID�

Serological tests could be specific to one type of immunoglobulin, they can concurrently measure IgM and IgG antibodies, or they may be absolute antibody examinations, which often measure IgA antibodies. 96 Based on the specific procedure and device, these experiments will usually be carried out within 1𠄲 hours after a sample arrives in the laboratory and is loaded onto the appropriate platform. 97 Guo et al. 98 indicated that IgA and IgM antibodies have positive rates of 93.0% and 85.5% after 3𠄶 days, respectively. Also, 78.0% of positive IgG antibodies were detected during 10� days. The efficiency of detection by an IgM enzyme‐linked immunposorbent assay (ELISA) is higher than that of qPCR after 5.5 days of symptom onset. After 5 days, IgM ELISA detection is more efficient than a qPCR.

Moreover, the combination of PCR and IgM ELISA increased the detection rate by 98.5%. 98 Xiang et al. 99 tested 63 infected patients of SARS𠄌oV𠄂 admitted to Jinyintan Hospital in Wuhan, Hubei, China. Patient serum samples were evaluated using an ELISA and indirect ELISA IgG capture. The study results indicate that IgM was positive with an accuracy of 64.3%, a sensitivity of 44.4% and a specificity of 100% in 28 of 63 samples. The sample identification of 52 cases also showed a positive IgG test with a sensitivity of 82.54%, a specificity of 100% and an accuracy of 88.8%. In addition, a sensitivity of 87.3% was achieved using IgM and IgG combination analysis. 99

Liu et al. evaluated the anti‐IgM and anti‐IgG produced against recombinant spike protein and nucleocapsid protein of SARS𠄌oV𠄂 in 397 PCR confirmed COVID� patients and 128 negative cases at eight distinct clinical sites. The average sensitivity and specificity of the examination was 88.5% and 90.5%, respectively. The findings showed considerable detection consistency among the different types of venous and fingerstick blood samples. Compared to a single IgM or IgG test, the IgM‐IgG combination analysis has a higher effectiveness and sensitivity. 37 , 100 Therefore, it is important and urgent to improve several sensitive and specific supplementary approaches for COVID� diagnosis.

2.5. CRISPR technique

Nucleic acid detection with CRISPR�s13a/C2c2 is a highly rapid, sensitive and specific molecular detection platform, which may aid in the epidemiology, diagnosis and control of the disease. In addition, Cas13a/C2c2 can detect the expression of transcripts in live cells and different diseases. 101 , 102 Zhang et al. presented a protocol for the detection of COVID� using the CRISPR diagnostics�sed SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing) technique. RNA fragments of the SARS𠄌oV𠄂 virus help detect target sequences of approximately 100 copies. The experiment is performed by isothermal amplification of the extracted nucleic acid of samples from patients and then amplification of the viral RNA sequence via Cas13 and is finally read out by a paper dipstick in less than 1 hour. 103 , 104 Huang et al. 105 established a CRISPR�sed assay by a custom CRISPR Cas12a/gRNA complex. They used a fluorescent probe to identify target amplicons produced by standard RT‐PCR or isothermal recombinase polymerase amplification. This method showed specific detection at places not equipped with the PCR systems needed for qPCR diagnostic tests in real time. The analysis allows the identification of SARS𠄌oV𠄂 positive samples with a test‐to‐response time of approximately 50 minutes and a detection limit of two copies of each sample to be detected. The findings of the CRISPR test on nasal samples collected from persons with COVID� were comparable with matched data achieved from the CDC𠄊pproved RT‐qPCR test. 105

Broughton et al. 106 described the development of a fast (< 40 min), simple‐to‐implement and precise CRISPR�s12�sed lateral flow test to diagnose SARS𠄌oV𠄂 from RNA extract from a nasal swab. Using artificial reference samples and clinical specimens from patients, comprising patients diagnosed with COVID� disease and 42 patients with other respiratory illnesses, they confirmed their process. This CRISPR�sed approach has provided a visual and quicker alternative option to the SARS𠄌oV𠄂 real‐time RT‐PCR method used in the US Centers for Disease Control and Prevention, with approximately 100% negative predictive agreement and 95% positive predictive agreement. 106

2.6. LAMP�sed technique

Loop‐mediated isothermal amplification (LAMP) is a new isothermal nucleic acid amplification method with great efficiency. This is used to amplify RNAs and DNAs with high specificity and sensitivity as a result of its exponential amplification feature and six particular target sequences diagnosed by four separate primers. 107 The LAMP assay is rapid and does not need high‐priced reagents or equipment. Furthermore, the gel electrophoresis method is widely utilized for investigation of the amplified items to detect endpoints. Hence, the LAMP test will help to decrease the cost of coronavirus detection. Several strategies for the detection of coronavirus based on LAMP are defined here, as developed and performed in clinical diagnosis. 108

Poon et al. 109 have reported a simple LAMP test in the SARS study and demonstrated the feasibility of this method for SARS𠄌oV detection. The SARS𠄌oV ORF1b site was selected for SARS detection and amplified in the presence of six primers via the LAMP reaction, and then the amplified products were assessed by gel electrophoresis. The sensitivity and detection levels in LAMP test for SARS are close to those of traditional PCR�sed techniques. Pyrc et al. 110 effectively applied LAMP to HCoV‐NL63 detection with a desirable sensitivity and specificity in mobile cell cultures and clinical specimens. Particularly, one replica of RNA template was found to be responsible for the detection restriction. Amplification is observed as fluorescent dye or magnesium pyrophosphate precipitation. These techniques can be achieved in real time by monitoring the turbidity of the pyrophosphate or fluorescence, which correctly overcome the restriction of endpoint detection. 110

Shirato et al. 111 developed a beneficial RT‐LAMP assay for the diagnosis and epidemiological monitoring of human MERSCoV. This method was highly specific, without any cross‐reaction with other specific respiratory viruses, and detected as few as 3.4 copies of RNA. 111 Subsequently, they developed the RT‐LAMP assay by revealing a sign using a quenching probe (QProbe), which has the same efficiency as the usual real‐time RT‐PCR test with respect to MERSCoV detection. 112

Based on other evidence, a nucleic acid visualization method was developed that combines RT‐LAMP and a vertical flow visualization strip for MERS detection. 113

2.7. Penn RAMP technology

Based on the effectiveness reported by Zhang et al. 104 using the comparatively less sensitive LAMP, the improved sensitivity of the Penn‐RAMP technique achieved by Huang et al. 114 , which is attributable to an updated two‐step LAMP protocol, can prove to be substantially effective as a diagnostic. To amplify specific targets by recombinase polymerase amplification, in which all targets are simultaneously amplified, the Penn‐RAMP requires a preliminary reaction with outer LAMP primers. A next highly precise LAMP reaction is then triggered. Especially, the first stage uses F3 and B3 outer LAMP primers, whereas the other four RAMP primers are further mixed in the stage 2. Compared to normal LAMP, this ‘nested’ concept considerably improved the sensitivity of LAMP by approximately 10� times, especially when working with distilled and crude samples. 115 Additionally, when extended to mock trials, the Penn‐RAMP methodology was given a 100% approval rating at 7� copies of viral RNA per reaction, compared to a 100% approval rating at the 700 viral RNA copies needed for PCR analysis. 114 , 115

2.8. Droplet digital PCR

For the direct identification and quantification of DNA and RNA targets, droplet digital PCR (ddPCR) comprises an extremely sensitive technique. 116 It has been widely used for infectious disease conditions, particularly because of its ability to identify a few copies of viral genomes accurately and efficiently. 117 If low‐level and/or residual viral existence identification is appropriate, ddPCR quantitative data are much more insightful than those provided by regular RT‐PCR tests. In view of the need to restrict (as far as possible) false‐negative results in COVID� diagnosis, use of the ddPCR can provide a vital support. Even so, the ddPCR assay is still very rarely studied in clinical settings and there is currently no available evidence for European cases. 118

2.9. Next‐generation sequencing (NGS)�sed technique

RNA viruses come in great assortment of varieties, and they are the etiological specialists of numerous significant human and animal infectious diseases. 119

RNA viruses comprise the major variety and are the etiologic agents of very infectious diseases in humans and animals such as SARS, hepatitis, influenza and IB (avian infectious bronchitis). High‐throughput NGS technology has a vital role in primary and accurate diagnosis. 120 In addition, the NGS method can detect whether or not various types of virus comprise a pathogen. The fast novel technique of viruses by NGS, including DNA‐sequencing and RNA‐sequencing has developed the identification of viral diversity. 121 The identification of a huge range of pathogen using NGS technologies is also significant for controlling viral infection caused by a new pathogen. 122 In recent years, the advancement of the NGS method via RNA‐sequencing has enabled us to make great progress in the fast recognition of new RNA viruses. RNAsequencing detects millions of reversely transcribed DNA fragments from complex RNA samples at the same time using random primers. 123 Chen et al. 122 reported a new duck coronavirus using the RNA‐sequencing method, which differed from that of chicken IBV (infectious bronchitis virus). 122 The new duck‐specific CoV was a possible new species within the genus Gamma𠄌oronavirus, as shown by sequences of the viral 1b gene from three regions.

In conclusion, the outbreak of a novel virus emerged at the end of December 2019. COVID� spread immediately and challenged medicine, economics and public health worldwide. Numerous evidence proposed that the ACE2 receptors comprise crucial structural proteins for virus budding and entry into host cells. Both transmission from unidentified intermediate hosts to cross‐species and human to human transmission have been recognized. Hence, early detection and isolation of suspected patients can play an essential role in controlling this outbreak. Currently, diagnostic methods for COVID� are numerous hence, it is imperative to choose a suitable detection protocol. Each of the described techniques has its specific disadvantages and advantages. Both chest CT imaging and RT‐PCR tests are recommended for COVID� patients. However, the use of PCR requires various equipment and a well𠄎stablished laboratory. LAMP can be detected with low numbers of DNA or RNA templates within 1 hour. Microarray is an expensive method for COVID� diagnosis, and other newly developed methods also require additional investigation to achieve rapid development and detection in the future. Given that the number of infected cases is rapidly increasing, future studies should reveal the secrets of the molecular pathways of the virus with respect to developing targeted vaccines and antiviral treatments.


MATERIALS AND METHODS

Materials

Gestyl (eCG) was purchased from Professional Compounding Center of America (Houston, TX). Pregnyl (hCG) was purchased from Organon Special Chemicals (West Orange, NJ), and FSH (oFSH-16) was a gift from the National Hormone and Pituitary Program (Rockville, MD). Fetal bovine serum was obtained from Hyclone Laboratories (Logan, UT). Hyaluronic acid (HA) fragments of relatively uniform size (∼150 kDa) were obtained from Hyalose (Oklahoma City, OK). Oligonucleotide poly-(dT) was purchased from Amersham Pharmacia Biotech (Piscataway, NJ) AMV reverse transcriptase and Taq polymerase were from Promega Corp. (Madison, WI) [P 32 ]dCTP was from ICN (Los Angeles, CA) oligonucleotide primers for RT-PCR reactions were from Sigma-Genosys (Houston, TX) routine chemicals were from Fisher Scientific (Pittsburgh, PA) or Sigma (St. Louis, MO). Antibodies used for WB, IF, and uptake studies are as indicated: SCARB1 (SR-B1 Novus Biologicals, Littleton, CO): WB, 1:2000 IF, 1:500 Uptake, 1:500. TLR4 (Cell Signaling Technology, Beverly, MA): WB, 1:1000 IF, 1:100 Uptake, 1:100. MYD88 (eBiosciences, San Diego, CA): WB, 1:1000 IF, 1:100 Uptake, 1:100. IRF3 (Cell Signaling Technology): WB, 1:1000 IF, 1:100 Uptake, 1:100. Phospho-p38MAPK: WB, 1:2000. Phospho-ERK1/2: WB, 1:2000. Phospho-NFκB: WB, 1:1000. NF-kB: WB, 1:1000 (Cell Signaling Technology). Secondary antibodies tagged with Alexa Fluor 594 (red) and Alexa Fluor 488 (green) as well as Lyso Tracker (red) DND-99 were purchased from Invitrogen (Carlsbad, CA).

Animals

Immature female C57BL/6 mice were obtained from Harlan, Inc. (Indianapolis, IN). On d 23 of age, female mice were injected ip with 4 IU of eCG (Pregnyl Organon, West Orange, NJ) to stimulate follicular growth, followed 48 h later with 5 IU hCG (Gestyl Diosynth, Oss, The Netherlands) to stimulate ovulation ( 43). Animals were housed under a 16-h light/8-h dark schedule in the Center for Comparative Medicine at Baylor College of Medicine and provided food and water ad libitum. Animals were treated in accordance with the NIH Guide for the Care and Use of Laboratory Animals, as approved by the Animal Care and Use Committee at Baylor College of Medicine.

Isolation of COCs and Granulosa Cells

Ovaries of immature mice primed with eCG for 48 h contain multiple PO follicles. COC cells were isolated from these follicles by needle puncture, collected by pipette, pooled, frozen, and stored at −80 C for RNA or protein extraction ( 10, 13). Granulosa cells that were released by needle puncture of the follicles were also pooled, collected by centrifugation, and frozen at –80 C for protein and RNA analyses. COCs and granulosa cells were also isolated from ovaries of eCG-primed mice after hCG treatment for 4, 8, and 12 h. During this time, COCs expand but have not yet ovulated. Ovulated (fully expanded) COCs were collected by needle puncture of the oviducts of mice 16 h or 24 h after hCG. Collection of each pool of COCs and granulosa cells (15 mice) at each time point was repeated two times (i.e. two separate experiments) ( 10). For culture, nonexpanded COCs (∼20–30) and granulosa cells were collected from the ovaries of eCG-treated mice, plated in separate wells of a Falcon 24-well plate (Becton Dickinson, Franklin Lakes, NJ) in 0.5 ml of defined medium ( 13) containing 1% fetal bovine seum without or with either FSH (100 ng/ml), Amphiregulin (AREG 250 ng/ml) ( 13), LPS (100 ng/ml), or HA (100 μg/ml). After specific time intervals, as designated in the figure legends, total RNA or protein was extracted from the COCs. In other experiments, ovulated COCs were collected from the oviduct after 16 or 24 h post-hCG injection. Each experiment was repeated two times.

RT-PCR Analyses

Total RNA was obtained from COCs and granulosa cells using the RNAeasy Mini kit (QIAGEN Sciences, Germantown, MD) according to the manufacturer’s instructions, and semiquantitative RT-PCR analyses were performed as described previously ( 44, 45). Briefly, total RNA was reverse transcribed using 500 ng poly-dT and 0.25 U avian myeloblastosis virus-reverse transcriptase at 42 C for 75 min and 95 C for 5 min. For the amplification of the cDNA products, specific primer pairs were selected as indicated in Table 1. All PCRs were done in the linear range of amplification and contained [ 32 P]dCTP, Taq Polymerase, and Thermocycle buffer. cDNA products were resolved on 5% polyacrylamide gels that were dried and exposed to x-ray film. The radioactive PCR product bands were quantified using a Storm 860 PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). The authenticity of the PCR products was verified by subcloning and sequencing. Total RNA was obtained from COCs and granulosa cells using the RNAeasy Mini kit (QIAGEN Sciences) according to the manufacturer’s instructions.

Specific Primer Pairs Selected for Amplification of cDNA Products

. Primer Pair (5′–3′, Forward and Reverse) . Size (bp) . Cycles .
C1q a unitGAAAGGCAATCCAGGCAATA 402 27
AAGATGCTGTCGGCTTCAGT
Cd14ACATCTTGAACCTCCGCAAC 538 27
AGTGACAGGTTCCCCACTTG
Cd34CCATCTCAGAGACTATGGTCAACTT 326 28
CTTTAGCCTCCTTGGATATCTGCTA
Cd36TCTCTGACACAGAGCTTATGAAATG 340 27
AGGTTGAATTTAAGGAACGACTTCT
Il-6CCGGAGAGGAGACTTCACAG 421 28
GGAAATTGGGGTAGGAAGGA
Irf-3GGTCTTCCAGCAGACACTCTTT 468 27
CATGTAGGAACAACCTTGACCA
L19CTGAAGGTCAAAGGGAATGTG 196 23
GGACACAGTCTTGATGATCTC
Myd88ATGTTCTCCATACCCTTG 365 30
ACTGCTTTCCACTCTGGC
Ptgs2TGTACAAGCAGTGGCAAAGG 433 24
GCTGTGGATCTTGCACATTG
Scarb1CAGGATAAGGAGGCCATTCA 598 27
GAAAAAGCGCCAGATACAGC
Tlr4ACCTGGCTGGTTTACACGTC 455 27
CAGGCTGTTTGTTCCCAAAT
Tlr8CAAACAACAGCACCCAAATG 591 27
CTGAGGGAAGTGCTGGAAAG
Tlr9TGCAGGAGCTGAACATGAAC 297 26
TAGAAGCAGGGGTGCTCAGT
TnfaAGTCCGGGCAGGTCTACTTT 422 26
GCACCTCAGGGAAGAGTCTG
. Primer Pair (5′–3′, Forward and Reverse) . Size (bp) . Cycles .
C1q a unitGAAAGGCAATCCAGGCAATA 402 27
AAGATGCTGTCGGCTTCAGT
Cd14ACATCTTGAACCTCCGCAAC 538 27
AGTGACAGGTTCCCCACTTG
Cd34CCATCTCAGAGACTATGGTCAACTT 326 28
CTTTAGCCTCCTTGGATATCTGCTA
Cd36TCTCTGACACAGAGCTTATGAAATG 340 27
AGGTTGAATTTAAGGAACGACTTCT
Il-6CCGGAGAGGAGACTTCACAG 421 28
GGAAATTGGGGTAGGAAGGA
Irf-3GGTCTTCCAGCAGACACTCTTT 468 27
CATGTAGGAACAACCTTGACCA
L19CTGAAGGTCAAAGGGAATGTG 196 23
GGACACAGTCTTGATGATCTC
Myd88ATGTTCTCCATACCCTTG 365 30
ACTGCTTTCCACTCTGGC
Ptgs2TGTACAAGCAGTGGCAAAGG 433 24
GCTGTGGATCTTGCACATTG
Scarb1CAGGATAAGGAGGCCATTCA 598 27
GAAAAAGCGCCAGATACAGC
Tlr4ACCTGGCTGGTTTACACGTC 455 27
CAGGCTGTTTGTTCCCAAAT
Tlr8CAAACAACAGCACCCAAATG 591 27
CTGAGGGAAGTGCTGGAAAG
Tlr9TGCAGGAGCTGAACATGAAC 297 26
TAGAAGCAGGGGTGCTCAGT
TnfaAGTCCGGGCAGGTCTACTTT 422 26
GCACCTCAGGGAAGAGTCTG

Specific Primer Pairs Selected for Amplification of cDNA Products

. Primer Pair (5′–3′, Forward and Reverse) . Size (bp) . Cycles .
C1q a unitGAAAGGCAATCCAGGCAATA 402 27
AAGATGCTGTCGGCTTCAGT
Cd14ACATCTTGAACCTCCGCAAC 538 27
AGTGACAGGTTCCCCACTTG
Cd34CCATCTCAGAGACTATGGTCAACTT 326 28
CTTTAGCCTCCTTGGATATCTGCTA
Cd36TCTCTGACACAGAGCTTATGAAATG 340 27
AGGTTGAATTTAAGGAACGACTTCT
Il-6CCGGAGAGGAGACTTCACAG 421 28
GGAAATTGGGGTAGGAAGGA
Irf-3GGTCTTCCAGCAGACACTCTTT 468 27
CATGTAGGAACAACCTTGACCA
L19CTGAAGGTCAAAGGGAATGTG 196 23
GGACACAGTCTTGATGATCTC
Myd88ATGTTCTCCATACCCTTG 365 30
ACTGCTTTCCACTCTGGC
Ptgs2TGTACAAGCAGTGGCAAAGG 433 24
GCTGTGGATCTTGCACATTG
Scarb1CAGGATAAGGAGGCCATTCA 598 27
GAAAAAGCGCCAGATACAGC
Tlr4ACCTGGCTGGTTTACACGTC 455 27
CAGGCTGTTTGTTCCCAAAT
Tlr8CAAACAACAGCACCCAAATG 591 27
CTGAGGGAAGTGCTGGAAAG
Tlr9TGCAGGAGCTGAACATGAAC 297 26
TAGAAGCAGGGGTGCTCAGT
TnfaAGTCCGGGCAGGTCTACTTT 422 26
GCACCTCAGGGAAGAGTCTG
. Primer Pair (5′–3′, Forward and Reverse) . Size (bp) . Cycles .
C1q a unitGAAAGGCAATCCAGGCAATA 402 27
AAGATGCTGTCGGCTTCAGT
Cd14ACATCTTGAACCTCCGCAAC 538 27
AGTGACAGGTTCCCCACTTG
Cd34CCATCTCAGAGACTATGGTCAACTT 326 28
CTTTAGCCTCCTTGGATATCTGCTA
Cd36TCTCTGACACAGAGCTTATGAAATG 340 27
AGGTTGAATTTAAGGAACGACTTCT
Il-6CCGGAGAGGAGACTTCACAG 421 28
GGAAATTGGGGTAGGAAGGA
Irf-3GGTCTTCCAGCAGACACTCTTT 468 27
CATGTAGGAACAACCTTGACCA
L19CTGAAGGTCAAAGGGAATGTG 196 23
GGACACAGTCTTGATGATCTC
Myd88ATGTTCTCCATACCCTTG 365 30
ACTGCTTTCCACTCTGGC
Ptgs2TGTACAAGCAGTGGCAAAGG 433 24
GCTGTGGATCTTGCACATTG
Scarb1CAGGATAAGGAGGCCATTCA 598 27
GAAAAAGCGCCAGATACAGC
Tlr4ACCTGGCTGGTTTACACGTC 455 27
CAGGCTGTTTGTTCCCAAAT
Tlr8CAAACAACAGCACCCAAATG 591 27
CTGAGGGAAGTGCTGGAAAG
Tlr9TGCAGGAGCTGAACATGAAC 297 26
TAGAAGCAGGGGTGCTCAGT
TnfaAGTCCGGGCAGGTCTACTTT 422 26
GCACCTCAGGGAAGAGTCTG

Western Blot Analyses

In Vivo Samples.

COCs and granulosa cells were collected from ovaries/oviducts of eCG-primed immature mice at 0, 8, and 16 h after hCG, pooled, and frozen at −80 C. WCEs were prepared by homogenizing each sample in high-salt WCE buffer ( 46).

In Vitro Samples.

Nonexpanded COCs and granulosa cells were isolated from PO follicles of eCG-primed mice and cultured in defined medium plated in separate wells of a Falcon 24-well plate in 0.5 ml of defined medium ( 13) without or with LPS (100 ng/ml) for 0, 60, and 120 min. The COC and granulosa cell samples were collected by centrifugation and extracted in SDS boiling buffer as described previously ( 10). WCE (3 μg protein) and SDS extracts (30 μl) were resolved by SDS-PAGE (10%) and transferred to Immobilon-P nylon membranes (Millipore Corp., Bedford, MA). Membranes were blocked in Tris-buffered saline and Tween 20 [TBST 10 m m Tris (pH 7.5), 150 m m NaCl and 0.05% Tween 20] containing 5% nonfat Carnation instant milk (Nestle Co., Solon, OH). Blots were incubated with selected primary antibodies overnight at 4 C. After washing in TBST, Enhanced chemiluminescence (ECL) detection was performed using Pierce Super Signal according to the manufacturer’s specifications (Pierce) and appropriate exposure of the blots to Kodak x-ray film. Specific bands were quantified by densitometric analyses using a Molecular Dynamics Personal Densitometer.

COCs were immobilized on polylysine-coated coverslips, fixed with 4% paraformaldehyde, washed with PBS, and used directly or stored in 1% paraformaldehyde. COCs were permeabilized with 0.5% Nonidet P-40 (NP-40), washed, blocked with 5% BSA or Vector M.O.M. immunodetection reagents (Vector Laboratories, Burlingame, CA), and incubated overnight at 4 C with selected primary antibodies as previously ( 10). Antibody localization was visualized with fluorescein isothiocyanate-labeled antirabbit IgG and Streptavidine AlexaFluor 568 (Molecular Probes). Nuclei were visualized by 4′,6-diamidino-2-phenylindole present in the VECTASHIELD D mounting medium (Vector Laboratories), propidium iodide, or PR-TOPO-3 (Molecular Probes). Digital images were captured using an Axiphot microscope with ×10–40 objectives or a Zeiss Laser Scanning Confocal Microscope (LSM 510 Carl Zeiss, Thornwood, NY).

Phagocytosis Studies

COCs were isolated from ovaries of eCG-primed mice 6 h after hCG, a time selected based on the induction of TLRs, CD14, and MYD88 between 4 and 8 h. COCs were cultured for 4 h in a 12-well culture dish (1 ml defined medium containing 5% serum) with 5 μg/ml of sonicated bacterial (Escherichia coli strain K12) particles in the Vybrant Phagocytosis Assay Kit (Invitrogen) ( 23). The COCs and bacteria were cultured either at 37 C in medium alone, at 37 C in the presence of cytochalasin B (16 μ m to inhibit cytoskeletal uptake mechanisms), or at 4 C (control). After 2 h culture, bacterial particles, COCs were washed twice (using a glass pipette) with medium containing 5% serum and then treated with hyalurondase for 1 min. After a 30-sec vortex (medium speed), the dispersed cells were collected by centrifugation at 10,000 rpm for 1 min. The supernatant was removed, 100 μl of trypan blue quenching solution was added, and the cells were collected again by centrifugation. The cells were washed in serum-free medium twice and then fixed in 2% paraformaldehye for 30 min. Cells were then spun onto (3-aminopropyl) triethoxysilane (Sigma A3648)-coated slides. The immobilized cells were washed in PBS, permeabilized in 0.5% NP-40, and then immunostained as described above using specific antibodies and DNA staining reagents. Granulosa cells obtained from ovaries of eCG-primed mice were plated on serum-coated coverslips in 12-well dishes and cultured in serum-free defined medium at 37 C for 24 h with bacterial particles (5 μg/ml) without or with FSH and additional 1 h in the presence of the lysosomal marker (Lyso Tracker 100 n m ). Granulosa cells were also cultured 24 h on coverslips and then incubated for 4 h with bacterial particles at 37 C. Cells were then washed, fixed in 2% paraformaldehyde 30 min, washed in PBS, permeabilized with 0.5% NP-40, and immunostained as described above and in the figure legends.

Statistics

The semiquantitative RT-PCR data are represented as mean ± sd . Data were analyzed by using GraphPad Prism Programs (ANOVA or t test and Neuman-Keuls Multiple Comparison Tests GraphPad Prism, San Diego, CA) to determine significance. Values were considered significantly different if *P < 0.05 or **P < 0.01 ( Figs. 1, 3, and 4).


Phagocytosis

Numerous cells are able to ingest foreign materials, but the ability to increase this activity in response to opsonization by antibody and/or complement, so as to acquire antigen specificity, is restricted to cells of the myeloid series, principally polymorphs, monocytes and macrophages these are sometimes termed ‘professional’ phagocytes.

Apart from some variations in their content of lysosomal enzymes, all these cells use essentially similar mechanisms to phagocytose foreign objects, consisting of a sequence of attachment (Figure 1. top), endocytosis or ingestion (Figure 1. center) and digestion (Figure 1. bottom). In the figure this process is shown for a typical bacterium. In general, bacteria with capsules are not phagocytosed unless opsonized, whereas many non-capsulated ones do not require this. There are certain differences between phagocytic cells e.g. polymorphs are very short-lived (hours or days) and often die in the process of phagocytosis, while macrophages, which lack some of the more destructive enzymes, usually survive to phagocytose again. Also, macrophages can actively secrete some of their enzymes, e.g. lysozyme. There are surprisingly large species differences in the proportions of the various lysosomal enzymes.

Several of the steps in phagocytosis shown in the figure may be specifically defective for genetic reasons, as well as being actively inhibited by particular microorganisms. In either case the result is a failure to eliminate microorganisms or foreign material properly, leading to chronic infection and/or chronic inflammation.

Figure 1. Phagocytosis and intracellular destruction of microbes.

Phagocytosis is an active, energy-dependent process of engulfment of large particles (>0.5 μm in diameter) into vesicles. Phagocytic vesicles fuse with lysosomes, where the ingested particles are destroyed. In this way, the mechanisms of killing, which could potentially injure the phagocyte, are isolated from the rest of the cell.

Neutrophils and macrophages express receptors that specifically recognize microbes, and binding of microbes to these receptors is the first step in phagocytosis. Some of these receptors are pattern recognition receptors, including C-type lectins and scavenger receptors. Phagocytes also have high-affinity receptors for certain opsonins, including antibody molecules, complement proteins, and plasma lectins these receptors are critical for phagocytosis of many different microbes that are coated with the opsonins. Once a microbe or particle binds to receptors on a phagocyte, the plasma membrane in the region of the receptors begins to redistribute and extends a cup-shaped projection around the microbe. When the protruding membrane cup extends beyond the diameter of the particle, the top of the cup closes over and pinches off the interior of the cup to form an inside-out intracellular vesicle. This vesicle, called a phagosome, contains the ingested foreign particle, and it breaks away from the plasma membrane. The cell surface receptors also deliver activating signals that stimulate the microbicidal activities of phagocytes. Phagocytosed microbes are destroyed, as described next at the same time, peptides are generated from microbial proteins and presented to T lymphocytes to initiate adaptive immune responses.

Pattern-recognition receptors: Phagocytic cells have surface and phagosomal receptors that recognize complementary molecular structures on the surface of common pathogens. Binding between pathogens and these receptors activates intracellular killing and digestion, as well as the release of many inflammatory chemokines and cytokines.

C3 receptor: Phagocytic cells (and some lymphocytes) can bind C3b, produced from C3 by activation by bacteria, etc., either directly or via antibody.

Fc receptor: Phagocytic cells (and some lymphocytes, platelets, etc.) can bind the Fc portion of antibody, especially of the IgG class. Binding of several IgG molecules to Fc receptors on macrophages or polymorphs triggers receptor activation, and activates phagocytosis and microbial killing.

Opsonization: This refers to the promotion or enhancement of attachment via the C3 or Fc receptor. Discovered by Almroth Wright and made famous by G.B. Shaw in The Doctor’s Dilemma, opsonization is probably the single most important process by which antibody helps to overcome infections, particularly bacterial.

Phagosome: A vacuole formed by the internalization of surface membrane along with an attached particle. The phagosome often fuses with the lysosome, thus exposing the internalized microorganism to the destructive power of the lysosomal enzymes or cathepsins. However, some pathogens (e.g. some species of Salmonella) have evolved ways to avoid phagolysosome fusion, and thus survive within the phagocyte unharmed.

Lysosome: A membrane-bound package of hydrolytic enzymes usually active at acid pH (e.g. acid phosphatase, DNAase). Lysosomes are found in almost all cells, and are vehicles for secretion as well as digestion. They are prominent in macrophages and polymorphs, which also have separate vesicles containing lysozyme and other enzymes together with lysosomes these constitute the granules whose staining patterns characterize the various types of polymorph (neutrophil, basophil, eosinophil).

Phagolysosome: A vacuole formed by the fusion of a phagosome and lysosome(s), in which microorganisms are killed and digested. The pH is tightly controlled, and varies between different phagocytes, presumably so as to maximize the activity of different types of lysosomal enzymes.

Activated neutrophils and macrophages kill phagocytosed microbes by the action of microbicidal molecules in phagolysosomes. Fusion of phagocytic vacuoles (phagosomes) with lysosomes results in the formation of phagolysosomes, where most of the microbicidal mechanisms are concentrated. Three classes of microbicidal molecules are known to be the most important.

1. Reactive oxygen species.
Activated macrophages and neutrophils convert molecular oxygen into reactive oxygen species (ROS), which are highly reactive oxidizing agents that destroy microbes (and other cells).
2. Nitric oxide.
In addition to ROS, macrophages produce reactive nitrogen species, mainly nitric oxide (NO), by the action of an enzyme called inducible nitric oxide synthase (iNOS).
3. Proteolytic enzymes.
Activated neutrophils and macrophages produce several proteolytic enzymes in the phagolysosomes that function to destroy microbes. One of the important enzymes in neutrophils is elastase, a broad-spectrum serine protease known to be required for killing many types of bacteria. Another important enzyme is cathepsin G. Mouse gene knockout studies have confirmed the essential requirement for these enzymes in phagocyte killing of bacteria.

Oxygen and the oxygen burst: Intracellular killing of many bacteria requires the uptake of oxygen by the phagocytic cell, i.e. it is ‘aerobic’. Through a series of enzyme reactions including NADPH oxidase and superoxide dismutase (SOD), this oxygen is progressively reduced to superoxide (O2?), hydrogen peroxide (H2O2), hydroxyl ions (OH?) and singlet oxygen (1O2). These reactive oxygen species (ROS) are rapidly removed by cellular enzymes such as catalase and glutathione peroxidase. ROS are highly toxic to many microorganisms but excessive ROS production may contribute to damage to host tissues, e.g. blood vessels in arteriosclerosis.

NO: Nitric oxide produced from arginine is another reactive oxygencontaining compound that is highly toxic to microorganisms when produced in large amounts by activated mouse macrophages its importance in human remains less well established. In contrast, much lower levels of nitric oxide are produced constitutively by endothelial cells, and have a key role in the regulation of blood vessel tone.

Myeloperoxidase: An important enzyme of PMNs that converts hydrogen peroxide and halide (e.g. chloride) ions into the microbicide hypochlorous acid (bleach). Reaction of antigens with hypochlorous acid may also enhance their recognition by T lymphocytes.

Lysozyme (muramidase): This lyses many saprophytes (e.g. Micrococcus lysodeicticus) and some pathogenic bacteria damaged by antibody and/or complement. It is a major secretory product of macrophages, present in the blood at levels of micrograms per milliliter.

Digestive enzymes: The enzymes by which lysosomes are usually identified, such as acid phosphatase, lipase, elastase, β-glucuronidase and the cathepsins, some of which are thought to be important in antigen processing via the MHC class II pathway.


Watch the video: Pattern Recognition Receptors (August 2022).